Letter T

Telomere

1,736 views

The end of a chromosome, a specialized structure involved in the replication and stability of the chromosome.

On the DNA level, the telomere is a dull stretch of road.

It is a length of DNA monotonously made up of a recurring motif of 6 nucleotide bases (namely, the sequence TTAGGG) together with various associated proteins.

The TTAGGG motif is tandemly repeated.

It reads TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG and so on.

Small amounts of these terminal TTAGGG sequences are lost from the tips of the chromosomes, but the addition of TTAGGG repeats by the enzyme telomerase compensates for this loss.

Many human cells progressively lose terminal TTAGGG sequences from their chromosomes during the process of cell division, a loss that correlates with the apparent absence of the telomerase enzyme in these cells.

Telomerase appears to play a role in the formation, maintenance, and renovation of telomeres.

There has been great interest in the possible relationship between human telomeres in the one hand and cellular senescence(aging) and cellular immortality on the other.

This interest includes the question of a role for telomerase in the malignant process and the question of the use of agents that inhibit telomerase as anti-tumor agents.

(In biochemical terms, telomerase acts as a telomerase-reverse transcriptase (TERT); it reverses the usual course of nucleic acid events (from DNA to RNA) and goes from RNA to DNA; it transcribes the RNA into DNA and so is a reverse-transcribing enzyme specific to the telomeric sequence.

Telomerase is itself a ribonucleoprotein (a complex of RNA and protein).

It has two unique features: it is able to recognize a single-stranded (G-rich) telomere primer and it is able to add multiple telomeric repeats to its end by using an RNA template.) A gene coding for telomerase has been located and 'mapped' to chromosome subband 5p15.33.

Share this definition

Medical disclaimer

The information on this page is for educational and informational purposes only and does not constitute medical advice in any way.

  • It does not replace the advice of a physician, pharmacist or other healthcare professional.
  • It does not represent a prescription of drugs, diagnostic exams or therapies.
  • In case of symptoms, doubts or concerns about your health, always consult a qualified physician.

In case of emergency call 911 (US) or 112 (EU).